Biology 2581 Tutorial 3 Section 27 Quiz

When preforming a screen on the maternal genome, how many generations of mutations does there need to be to study the effects of her offspring?

• F1
• F2
• F3
• F3

! A research team aims to investigate the function of a specific gene ' in fruit fly development. They plan to use CRISPR-Cas9 technology to introduce targeted mutations into the gene of interest. Which of the following steps accurately describes how CRISPR-Cas9 can be applied in this scenario?

• Designing guide RNAs that specifically target regions within the fruit fly genome unrelated to the gene of interest.
• Using CRISPR-Cas9 to insert random mutations across the entire fruit fly genome.
• Designing guide RNAs that specifically target regions adjacent to the gene of interest, followed by Cas9-induced double-stranded breaks.
• Introducing the CRISPR-Cas9 system directly into the fruit fly eggs without any prior genetic manipulation.
• Employing CRISPR-Cas9 to modify gene expression without : inducing any DNA changes.

How does RNA interference (RNAi) differ from CRISPR-Cas9 in gene silencing?

• A) RNAi silences genes post-transcriptionally, while CRISPR-Cas9 can inhibit transcription directly
• B) RNAi uses Cas9 proteins to degrade mRNA, whereas CRISPR uses guide RNA
• C) RNAi permanently alters the DNA, while CRISPR-Cas9 effects are temporary
• D) RNAi can activate gene expression, in contrast to CRISPR-Cas9 which only silences genes

Question: which of the following is correct about forward and reverse genetics?

• Reverse genetics is a phenotype to genotype approach
• Forward genetics is a genotype to phenotype approach
• Reverse genetics relies on mutagenesis to create a randomized pool of genomic variants
• Screening looks through all variants for the desired phenotype
• Canavinine resistance is an example of selection, where only the variant survives

According to the lecture, lin-14 encodes a _________.

• non-coding RNA
• siRNA
• miRNA
• Mitochondrial Protein
• Nuclear Protein

Which of the following sequences best describes the process involving the manipulation of genetic material in organisms for a systematic genomic screen in the correct order?

• A) Insert double-stranded DNA into worms, create a cDNA library, induce expression in E. coli, distribute double-stranded DNA to C. elegans. This is an example of forward genetics only.
• B) Set up a library of all cDNA from the genes of C. elegans into a plasmid in E. coli by putting promoters on both sides, induce expression in the strain of E. coli containing double-stranded RNA from the two promoters inside, and feed it to the C. elegans. This is an example of forward and reverse genetics.
• C) Create a cDNA library, induce expression in E. coli, insert it into plasmid, distribute double-stranded DNA to C. elegans. This is an example of reverse genetics only.
• D) Isolate cDNA from worms, create a cDNA library, induce expression in E. coli, insert it into plasmid, distribute double-stranded DNA to C. elegans. This is an example of forward and reverse genetics.
• E) Induce expression in E. coli containing double-stranded RNA from the two enhancers inside, create a cDNA library, insert it into plasmid, distribute double-stranded DNA to C. elegans. This is an example of reverse and forward genetics.

What is required for successful binding of Cas9 to DNA target sequence?

• PAM sequence
• PASH-1
• Tracer DNA
• Methylation of DNA target sequence

Write the first 10 bases of the RNA sequence 5’ to 3' for a base guide RNA sequence to create a double stranded break in the following sequence: TAGCATTACGAGCCTATCGGTAGAGCAGCATTA

• AUGCCAUCUC
• UCGUAAUGCU
• CUCUACCGAU
• AAUGCCAUCU
• None of the above.

When a bacteriophage infects its phage DNA into a cell, and the cell uses restriction enzymes to cut the phage DNA, why is the host cell’s DNA not cut up as well?

• Restriction enzymes are only compatible with phage DNA
• All restriction sites on the host DNA are acetylated
• All restriction sites on the host DNA are methylated
• Host cell’s DNA is cut up, but quickly ligated back together