MIC220 TEST 1 revision

Find the FALSE statement about the domain bacteria

• Main composition of the cell wall is peptidoglycan

• Their membrane lipids composed of straight carbon chains attached to glycerol by ester linkage

• They are prokaryotic same as domain Archaea

• They are composed of branched carbon chains attached to glycerol by ether linkages

In the taxonomic level, find two organisms have the most characteristics in common

• 2 organisms in the same family

• 2 organisms in the same class

• 2 organisms in the same phylum

• 2 organisms in the same order

Indicate which is the basic unit of taxonomy

• Genus

• Species

• Domain

• Phylum

Estimate the genomic DNA G+C content of the following:

 

ATTCGTCGGTTTAACTGCAC           

• 32%

• 40%

• 45%

• 50%

Indicate the name of the molecular technique used where two complementary single-stranded DNA of different organisms are allowed to form a double-stranded molecule. The bonding is dependent on the appropriate base-pairing across the two single-stranded molecules. This technique allows to measure the degree of genetic similarity between pools of DNA sequences.

• DNA fingerprinting

• Western Blot

• DNA-DNA hybridization

• 16S rRNA sequencing

Indicate which of the following statement is NOT TRUE about the Gram positive bacteria.

• Contain thick peptidoglycan cell wall

• LPS is not presented

• Can be determined using Mannitol salt agar.

• Retain crystal violet and dark blue purple color in gram-stain

Describe the function of adding carbol fuchsin in acid fast staining procedure.

• As primary stain during the acid-fast staining process

• It is a type of lipid soluble phenolic compound that able to penetrate cell of the acid fast bacteria

• To stain the colour of acid fast cell and differentiate with non acid fast cell

• All of the statement are true

A patient came to the clinic with symptoms of food poisoning. When the microbiologist plated the stool sample on the EMB agar, he observed colonies with green metallic shine. Infer the bacterial species based on the observation

• Escherichia coli

• Shigella flexneri

• Salmonella enteritidis

• Klebsiella pneumoniae

Indicate which steps are correct for the capsule staining.

• Stain with malachite green  steam  decolorizing  counter-stain with safranin

• Stain with negative stain  allow to dry  counter stain with crystal violet 1 minute  examine

• Stain with negative stain  decolorising  counter-stain with safranin  examine

• Stain with safranin  decolorizing  steam  counter-stain with malachite-green

Infer the observation for Staphylococcus saprophyticus in Gram staining and coagulase test.

• Purple bacilli and clumping of plasma

• Pink cocci and no clumping of plasma

• Pink bacilli and clumping of plasma

• Purple cocci and no clumping of plasma