Gel Electrophoresis/PCR

Based on these results whose blood was found in the blood stain at the crime scene?

• Bob
• Sue
• John
• Lisa

Which two bear species are most closely related?

• Bear 1 and Bear 2
• Bear 1 and Bear 3
• Bear 2 and Bear 3
• There’s no way to tell

Tags

NGSS.HS-LS4-1

NGSS.HS-LS4-2

Which man is the father of this baby?

• Father 1
• Father 2
• Father 3
• None of them

Tags

NGSS.HS-LS3-1

NGSS.HS-LS3-2

DNA fingerprinting works because

• Most genes are dominant
• All organisms contain RNA
• The most important genes are different among most people
• No two people, except identical twins, have exactly the same DNA 

Tags

NGSS.HS-LS3-2

DNA is recovered from a suspected dead soldier.  Which Parents are the likely parents of the soldier?

• Parents C and D
• Parents E and F
• Parents A and B
• Parents G and H

Tags

NGSS.HS-LS3-1

What is the purpose of gel electrophoresis?

• helps cut DNA
• count the genes in DNA
• separates DNA based on size
• allows for an exact replicated organism

Why do the fragments of DNA in gel electrophoresis travel away from the negative electrode?

• DNA is negatively charged so attracted to the positive end of the unit
• DNA is positively charged to attracted to the negative end of the unit
• the agarose gel in negatively charged
• the agarose gel is positively charged

Which is the primary purpose of using restriction enzymes in gel electrophoresis?

• It allows the strands of DNA to be cut into various lengths for testing
• It restricts the number of base pairs that can be tested in a sample
• It makes the testing simpler by moving the strands into the gel faster
• It charges the DNA strands

In gel electrophoresis, the largest DNA fragment will appear

• closest to the starting wells
• farthest from the starting wells
• three quarters away from the starting wells
• it depends on how many fragments there are

Tags

NGSS.MS-PS2-5

Restriction Enzyme A reads AGTC and cuts between G and T.  Cut the following DNA:
ACTCAGTCCTCTAAGCCAGTCCTCAAAAGTC
How many fragments are there?

• 1
• 2
• 3
• 4