Genetic Disorders Quiz

What is the role of genes in protein synthesis?

• Genes code for proteins

• Genes destroy proteins

• Genes store proteins

• Genes transport proteins

What is the complexity of DNA attributed to?

• The number of nucleotides

• The arrangement or sequence of nucleotides

• The type of nucleotides

• The presence of proteins

What is the structure of DNA?

• Single stranded

• Double stranded (forms a double helix)

• Triple stranded

• Quadruple stranded

What is mRNA?

• A type of DNA

• A type of RNA used in protein production

• A type of protein

• A type of sugar

Which base is found in RNA but not in DNA?

• A

• T

• U

• C

What are the base pairing rules for RNA?

• A pairs with T, C pairs with G

• A pairs with U, C pairs with G

• A pairs with G, C pairs with T

• A pairs with C, T pairs with G

This newly created mRNA molecule moves to the ____ (part of cell) where the process of translation can occur.

• Ribosome

• Nucleus

• Golgi apparatus

• Lysosome

What is the purpose of the activity mentioned in the document?

• To transcribe and translate a short sequence of DNA

• To measure the length of a gene

• To identify different types of proteins

• To analyze the structure of a double helix

What is the sequence of DNA provided in the document?

• GATCGATACCATTCGGCGCATAC

• GATCGATACCATTCGGCGCATACCTTCG

• GATCGATACCATTCGGCGCATACCTT

• GATCGATACCATTCGGCGCATACCT

What is the purpose of the laboratory notebook in the document?

• To record and transcribe the DNA sequence

• To measure the length of DNA

• To identify proteins

• To analyze RNA