DNA vs RNA, Protein Synthesis

Which base in RNA is replaced by uracil?

• Guanine

• Cytosine

• Thymine

• Adenine

• Uracil

How many mRNA codons are illustrated below?

AUGCGAUGAGAUCGAGGACCG

• 3

• 5

• 7

• 9

• 21

What is the name of the enzyme that creates the mRNA copy from DNA and is also involved in the synthesis of tRNA, and rRNA?

• Catalase

• Lactase

• Helicase

• RNA Polymerase

What is the name of the sugar in the mRNA nucleotides?

• Sucrose

• Ribose

• Deoxyribose

• Glucose

• Lactose

Which of the following pertain to RNA?

(Check all boxes that apply)

• Messenger

• Transport

• Ribosome

• Transfer

• Ribosomal

Which of the following is attached to the transfer RNA (tRNA)?

• An Amino Acid

• A Ribosome

• A DNA molecule

• A Lil' Baby

• A Cell Membrane

Which of the following is not part of protein synthesis?

• replication

• transcription

• translation

Tags

NGSS.HS-LS1-1

Which characteristic distinguishes a DNA molecule from a protein molecule?

• is composed of subunits

• can replicate itself

• is found in the cytoplasm

• can be very large

Tags

NGSS.HS-LS1-1

Amino acids are held together by __?__ bonds.

• Hydrogen Bonds

• Peptide Bonds

• Covalent Bonds

• James Bonds

If the mRNA codon reads adenine, uracil, and guanine, which amino acid would it code for using this codon chart?

• Arg- Arginine

• Ser- Serine

• Met-Methionine (start)

• Asp- Aspartic acid

Tags

NGSS.HS-LS1-1

NGSS.HS-LS1-6