PBS 2.2.1 2.2.2

Within a cell, DNA is housed in the _____.

Tags

NGSS.MS-LS1-2

When a protein needs to be made, a signal is sent to a cell to turn on the ____ that codes for the needed protein. This is the start of transcription.

Transcription occurs inside the _______ (cell organelle).

During transcription, DNA is read by an enzyme called ___ __________ and produces mRNA (m=messenger).

This newly created mRNA molecule enters the _________ where DNA cannot go.

During translation, small organelles called _________ read the mRNA sequence.

These organelles direct tRNA (t=transfer) molecules to bring a specific sequence of _____ _____.

Tags

NGSS.HS-LS1-1

A _____ is a sequence of three mRNA bases that codes for one amino acid.

When all the amino acids coded for by a gene link, they fold, and this creates a functional _______.

Tags

NGSS.HS-LS1-1

In your notebook, you transcribed this segment of DNA.

GATCGATACCATTCGGCGCATACTTCG

How many codons will be on the resulting mRNA strand?

• 9

• 27

• 13

• 20