BIO2581B - Section 003 - Tutorial 3

In a functional complementation assay using yeast, a plasmid containing a wild-type allele of the gene LEU2 is introduced into a yeast strain with a leu2 loss-of-function mutation. What is the primary purpose of this experiment?

• To increase the mutation rate in the yeast genome
• To confirm that the LEU2 gene is responsible for leucine biosynthesis
• To create a yeast strain resistant to antibiotics
• To study the effects of overexpressing the LEU2 gene
• All of the above

In a maternal effect screen involving a mother homozygous for a bicoid loss-of-function allele, which statement accurately describes the observed phenotype in the F4 generation?

• The mother displays a mutated phenotype, resulting in abnormal eggs with missing structures in the F4 generation.
• The mother appears normal, but her progeny in the F4 generation exhibit abnormalities (missing heads/ abdomen).
• The F4 generation shows a complete rescue of the mutated phenotype, indicating a compensatory mechanism in the maternal genome.
• The mother produces eggs with normal development, but the larvae in the F4 generation lack mutational effects.
• Both the mother and F4 generation exhibit a mutated phenotype due to the bicoid loss-of-function allele.

What is true about the maternal effect?

• it can be used in reverse genetics since we can reconstruct the genotype after observing the phenotype of the embryo.
• Maternal effect is usually manifested in the adult species
• The father doesn't contribute to the genotype of the embryo in maternal effect
• Male doesn't contribute to the phenotype of the offspring even in the later stages of life if maternal effect takes place
• Males can transmit genes responsible for maternal effects to future generations.

What modern technology has greatly simplified the process of identifying genes in genetic studies?

• a) Polymerase Chain Reaction (PCR)
• b) Western blotting
• c) Whole genome sequencing
• d) Gel electrophoresis
• Na

How many of the following are correct? 1. CRISPR-Cas9 complex does not recognize targets lacking PAM 2. Cas9 would recognize this dsDNA sequence: CAACTGCATAATCGAGTCATTTACATG 3. CRISPR associated nuclease can be used to label specific sequences 4. the repeated palindromic sequences prevent Cas9 from cutting the CRISPR array 5. the CRISPR array contains PAM sequences

• a) 1,3,4 & 5
• b) 1,2 & 3
• c) 4 & 5
• d) 1 & 3
• e) 1,2,3 & 4

You performed a screen for Drosophila maternal effect mutations that result in embryos with no abdomen (lack of Hunchback expression). You identified 8 independent, recessive, mutant alleles. You perform crosses to make mothers that contain two mutant alleles. You determine if the embryo in the egg laid by these mothers develops with abdomen (+) or with no abdomen (-).

• non-complementation the same complementation group
• non-complementation different complementation groups
• epistasis the same complementation group
• complementation the same complementation group
• complementation different complementation groups

Which of the following is true about siRNA?

• siRNA is initially single stranded
• siRNA cleaves complementary double-stranded RNA to degrade it
• siRNA has limited complementarity
• siRNA is an artificial tool for knockdown of gene expression
• siRNA is translated to protein

Question: A researcher is utilizing a forward genetics approach to isolate and identify genes responsible for wing development in the "Flutterfly," a model organism with normally functioning wings. After mutagenesis, they observe a subset of Flutterflies with dysfunctional wings. To determine whether the dysfunctional wing phenotype is due to mutations in the same gene or in different genes, the researcher should perform:

• A) A genetic screen by treating all variants with a selective agent and observing survival.
• B) A selection by exposing all mutants to a restrictive condition that only allows survival of Flutterflies with functional wings.
• C) A complementation analysis by intercrossing the mutants and assessing the phenotype of the progeny.
• D) Transformation by reintroducing DNA into the surviving Flutterflies to correct the wing dysfunction.
• E) A maternal effect screen by crossing mutants to create F3 homozygous mothers and observing their F4 offspring.