IB Nucleic acids

In which direction does DNA replication occur?

• 3'->5'

• 3'->3'

• 5'->3'

• 5'->5'

In the Hershey and Chase experiment the presence of an isotope of which element in the bacteria in the pellet after centrifugation indicated that DNA was the genetic material

• Sulphur

• Carbon

• Nitrogen

• Phosphorous

Identify the enzyme that adds nucleotides in a 5'->3' direction on the leading strand.

• DNA gyrase

• DNA polymerase III

• DNA polymerase I

• DNA Primase

State the enzyme that uncoils the DNA double helix

Identify the enzyme that adds a short length of RNA to a template strand of DNA

• DNA Ligase

• DNA polymerase I

• DNA gyrase

• DNA primase

State the term for the newly synthesised DNA formed between RNA promers on th elagging strand

In eukaryotes the coding sequence on DNA is interrupted by non-coding sequences. Identify the term for the non coding sequences.

• Introns

• Promoter

• Exons

• Histones

How many tandem repeats are there in the sequence: GATAGATAGATAGATAGATA

• 2

• 4

• 5

• 20

Identify the repetitive base sequences found at the end of chromosomes that are not replicated

• Exons

• Codons

• Terminator

• Telomeres

There are genes for tRNA and rRNA

• True

• False