IB Biology Topic 2.7 Review

Which of the following best describes the replication of DNA?

• 
• 
• 

Which of the following best describes the role of helicase

• Helicase unwinds the DNA double helix for future ease of separation.

• Helicase breaks the bonds between the nitrogenous bases.

• Helicase splits the two original strands apart so they can be replicated.

• All of the above.

Which best describes the role of DNA polymerase in replication?

• It builds up a new strand of DNA from nucleotides while moving away from the replication fork.

• It builds up a new strand of DNA from nucleotides while moving in any direction along the strand.

• It builds up a new strand of DNA from nucleotides while moving from the 5' terminal to the 3' terminal.

• It builds up a new strand of DNA from nucleotides while moving from the 3' terminal to the 5' terminal.

Which of the following enzymes are used in transcription?

(select one answer)

• RNA polymerase

• DNA polymerase

• Primase

• mRNA

The mRNA that results from transcription is:

• Complementary to the antisense strand.

• Complementary to the sense strand.

• A random chain of nucleotides.

• None of the above

Which of the following is not used during translation?

• mRNA

• tRNA

• rRNA

• DNA

Which codon initiates translation?

• AUG

• UAC

• MET

• UAA

Using the table below, determine the amino acid sequence that corresponds to the following mRNA sequence:

AUGACUUUGGUGUAAAAAUGA

• Met-Thr-Leu-Val-Lys

• Thr-Leu-Val

• Met-Thr-Leu-Val

• Met-Thr-Leu-Val-STOP

Tags

NGSS.HS-LS1-1

Which of the following could be an anticodon carrying the amino acid proline (pro)?

• GGU

• CCA

• CCC

• GGG

Describe the process of Translation.