A point mutation changes a codon in an mRNA molecule. Will the mutation affect the polypeptide that forms? Why?

Maybe. Some pairs of codons are translated into the same amino acid.

Frieda claims she can determine which sex chromosome was donated by the male and female parents from a human karyotype. Under which condition is her claim accurate? Options: The karyotype was taken from a newborn baby, The karyotype was taken from a male, The karyotype was taken from a female, The karyotype includes three copies of an autosome.

The karyotype was taken from a male.

A scientist has divided a DNA molecule into several fragments. Next, the scientist would use gel electrophoresis to accomplish which task?

separating the fragments by size

How did the change in the gene cause the change in phenotype? Options: by directing the cell to produce a carbohydrate instead of a protein, by altering the number of chromosomes in the cell, by affecting the amino acid sequence of a protein, by affecting the arrangement of glucose molecules in a carbohydrate

by affecting the amino acid sequence of a protein

Lucille has her personal genome analyzed. The report states that her genome includes one copy of the defective allele that causes cystic fibrosis, an autosomal recessive disease. Lucille is surprised by the report, because she is unaware of the disease in her family history, and she shows no symptoms of it. Lucille asks a genetic counselor if her future children are at risk for suffering the serious symptoms of cystic fibrosis.

A future child might suffer from cystic fibrosis if the father's genetic report is the same as Lucille's report.

Which event involving the rooster's parents is MOST LIKELY to have occurred? Mrs. Jorgensen keeps a flock of chickens in her back yard. One of the roosters is the result of selective breeding by Mrs. Jorgensen. The rooster is especially tall and muscular, and it has especially thick and colorful feathers.

Mrs. Jorgensen selected both of the rooster's parents, based on their body traits.

Which cross of potato plants would have been MOST USEFUL for producing a useful strain by hybridization? Options: a plant that is not disease resistant crossed with a plant that produces a low volume of food, a disease-resistant plant crossed with a plant that produced a high volume of food, a disease-resistant plant crossed with a plant that is not disease resistant, a disease-resistant plant crossed with a plant that produced a low volume of food

a disease-resistant plant crossed with a plant that produced a high volume of food

A team of scientists is studying the genome of the pine tree. They have identified a gene that produces a protein that is specific to pine trees. Accomplishing which of the following tasks would require the scientists to incorporate the gene into recombinant DNA? making multiple copies of the section of DNA that contains the gene, identifying the transcription factors that control the expression of the gene, identifying the sequence of nucleotides in the gene, engineering bacteria to use the gene to produce the pine tree protein

identifying the transcription factors that control the expression of the gene

When gene therapy is successful, how does it treat genetic disorders like cystic fibrosis?

by replacing a faulty gene with a normal gene in the human genome

Kathy donates a sample of her DNA for scientific analysis. Can the analysis reveal private information about her? Why or why not?

Yes. It can reveal ethnic heritage, the presence of certain diseases, and evidence for criminal cases.

Scientists before Darwin had proposed that living things could change over time. Why was Darwin's theory of evolution more powerful and useful than the proposals of the other scientists?

Darwin explained the mechanism by which evolution occurred.

According to Darwin's ideas about evolution, which of these meadow organisms has the greatest fitness? a lone tree that grows in the middle of the meadow, a snake that eats many mice, and then is eaten by a hawk, a female mouse that has many offspring, a large, healthy hawk that does not find a mate

a female mouse that has many offspring

The wings of ostriches are examples of vestigial structures. The wings provide evidence for which of these evolutionary relationships?

An ancestor of ostriches had useful wings.

A scientist predicts that the average ear shape of the goats will change gradually over time. According to Darwin's ideas about evolution and natural selection, the accuracy of the prediction depends on which of these conditions?

Certain ear shapes help the goats survive and reproduce on the island.

Giraffes, camels, and horses share some traits, although they vary in other traits. Which statement accurately describes the evolution of these species?

Each species descended from an ancient common ancestor.

In the Linnaean system of classification, camels are members of the order Artiodactyla and the family Camelidae. Llamas are also members of the family Camelidae. Based on this information, are llamas members of the order Artiodactyla?

Yes, because all family members are classified together in the same order.

Scientists now classify all living things into 6 kingdoms. Which of the following groups of organisms is classified into the greatest number of kingdoms? Options: humans and other multicellular organisms that are about the same size as humans, organisms that are microscopically small and each made of a single cell, plants and animals that are smaller than humans but still visible, multicellular animals that are larger than humans

organisms that are microscopically small and each made of a single cell

The domain is a relatively new taxonomic category. Which statement best explains why scientists added the domain to the Linnaean classification system? Options: Prokaryotic cells are much smaller than eukaryotic cells., The two groups of prokaryotes differ greatly from each other and from eukaryotes., A prokaryotic cell lacks a nucleus, while a eukaryotic cell has a nucleus., All prokaryotes are single celled, while many eukaryotes are multicellular.

The two groups of prokaryotes differ greatly from each other and from eukaryotes.

Which statement about the evolution of eukaryotes supports the grouping of the kingdoms into domain Eukarya? a. All eukaryotic species descended from a common eukaryotic ancestor. b. Each eukaryotic kingdom descended from a unique prokaryotic ancestor. c. Protists evolved first, then the fungi appeared, and then plants and animals. d. Species in the four eukaryotic kingdoms evolved independently of one another.

All eukaryotic species descended from a common eukaryotic ancestor.

While examining a sample of water under the microscope, Laura noticed two bacteria that appeared to be attached by a narrow tube. What is Laura observing?

The bacteria are in the process of conjugation.

What factor limits the size of bryophytes?

They do not have vascular tissue, so they cannot move water against gravity.

Many plants make seeds in berries. What advantage does the berry provide?

The berry entices animals to disperse the seed.

Root systems are classified as fibrous root systems and taproot systems. Which property distinguishes the two types of root systems from each other?

the branching pattern of the roots

Which of the following groups include the world’s five major food crops? Options: corn, rice, soybeans, potatoes, carrots, hay, rice, corn, soybeans, wheat, barley, corn, soybeans, hay, rice, peas, barley, rice, corn, wheat

hay, rice, corn, soybeans, wheat

What determines whether the relationship of microorganisms in the human digestive tract is parasitic or mutualistic?

whether their actions harm or benefit the human host

Food digestion occurs in much the same way in all vertebrates and many invertebrates. Which describes this common process?

Food is broken down in a digestive cavity, and then nutrients are absorbed.

Which statement describes how the function of the lungs relates to the function of another organ system?

The lungs depend on the circulatory system to transport carbon dioxide from cells and oxygen to cells.

What is the most significant cause of cell differentiation in a multicellular organism?

differences in gene regulation and gene expression among the cells

which feature is found in an open circulatory system, but never in a closed circulatory system? Options: Blood in a single loop between a heart, respiratory organ, and body capillaries, sinuses where body tissues are bathed in blood, Blood in a double loop between a heart, respiratory organ, and body capillaries, multiple hearts that pump blood through the system

sinuses where body tissues are bathed in blood

Bio Final

Flashcard

•

Others

•

10th Grade

•

Practice Problem

•

Hard

Wayground Content

FREE Resource

Student preview

49 questions

Show all answers

FLASHCARD QUESTION

Front

If 35% of an organism’s DNA is thymine, what is the percentage of guanine?

Back

15%

FLASHCARD QUESTION

Front

Chargaff’s rules of base pairing are explained by which structural feature of DNA?

Back

DNA is double stranded, and hydrogen bonds between base pairs hold the strands together.

FLASHCARD QUESTION

Front

What would happen if a cell divides before DNA replication is completed?

Back

Daughter cells would receive incomplete genetic information, but would regain lost information in the S phase.

FLASHCARD QUESTION

Front

The sequence of nitrogenous bases on a portion of a strand of DNA is shown in the diagram. From left to right, what is the corresponding sequence of the complementary strand?

Back

CCACTGA

FLASHCARD QUESTION

Front

Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U). Alvin's observation most strongly supports which of these conclusions?

Back

The nucleic acid is a form of RNA, and is not DNA.

FLASHCARD QUESTION

Front

Which type or types of RNA contain a copy of the instructions that a gene carries?

Back

mRNA only

FLASHCARD QUESTION

Front

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow? AUGCCACAGGGUUCAUCCGAA…

Back

Separate the list into three-letter "words."

Access all questions and much more by creating a free account

Create resources

Host any resource

Get auto-graded reports

Continue with Google

Continue with Email

Continue with Classlink

Continue with Clever

or continue with

Microsoft

Apple

Others

Already have an account?

Similar Resources on Wayground

50 questions

Flashcard Unit 1

Flashcard

•

8th Grade

31 questions

Passé composé & imparfait

Flashcard

•

9th - 11th Grade

40 questions

19 3D graphics

Flashcard

•

University

31 questions

Preguntas sobre Ordenanzas Educativas

Flashcard

•

11th Grade

37 questions

Quiz-VOCAB ONLY Chp 4B QUIERES IR CONMIGO

Flashcard

•

7th Grade

42 questions

3/4 영영 Vocabulary Flashcards

Flashcard

•

10th Grade

34 questions

6.1 Introduction to the Atmosphere

Flashcard

•

11th - 12th Grade

35 questions

Climate Change Vocabulary

Flashcard

•

9th Grade

Popular Resources on Wayground

15 questions

Fractions on a Number Line

Quiz

•

3rd Grade

20 questions

Equivalent Fractions

Quiz

•

3rd Grade

25 questions

Multiplication Facts

Quiz

•

5th Grade

54 questions

Analyzing Line Graphs & Tables

Quiz

•

4th Grade

$fractions$

22 questions

fractions

Quiz

•

3rd Grade

20 questions

Main Idea and Details

Quiz

•

5th Grade

20 questions

Context Clues

Quiz

•

6th Grade

15 questions

Equivalent Fractions

Quiz

•

4th Grade

Discover more resources for Others

20 questions

-AR -ER -IR present tense

Quiz

•

10th - 12th Grade

10 questions

Understanding Meiosis

Interactive video

•

6th - 10th Grade

15 questions

Making Inferences

Quiz

•

7th - 12th Grade

18 questions

SAT Prep: Ratios, Proportions, & Percents

Quiz

•

9th - 10th Grade

15 questions

Main Idea and Supporting Details.

Quiz

•

4th - 11th Grade

12 questions

Parallel Lines Cut by a Transversal

Quiz

•

10th Grade

12 questions

Add and Subtract Polynomials

Quiz

•

9th - 12th Grade

7 questions

How James Brown Invented Funk

Interactive video

•

10th Grade - University